Brook Bibbles Digital Cryptocurrency Dog - Mix of Shiba Inu, Poodle, Schnauzer, Labrador BK, Dachshund, Labrador, Corgi, Husky and Yorkshire Terrier

Achievements

Racer
Brook Bibbles
Rolling around on the carpet after a bath is my favorite way to dry. I slept with a cat and I liked it. I'm into recreational spankings and a little 'ruff' play. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 6%
  • Age 15 months
  • Racing Exp 7
  • Shiba Inu 27%
  • 1 races
  • Gen 0
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time17.87 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACATAGTAGTAGCAGGACCAAGCACAGTATTA
G
A
C
A
T
A
G
T
A
G
T
A
G
C
A
G
G
A
C
C
A
A
G
C
A
C
A
G
T
A
T
T
A
Genes: ICEE6A5O4EF

Composition

Shiba Inu
27%
Poodle
9%
Schnauzer
9%
Labrador BK
9%
Dachshund
9%
Labrador
9%
Corgi
9%
Husky
9%
Yorkshire Terrier
9%

Current Energy

Vitality -37 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Schnauzer
Legs Shiba Inu
Front Legs Shiba Inu
Head Labrador BK
Ears Dachshund
Snout Labrador
Mouth Corgi
Nose Husky
Eyes Shiba Inu
Color Yorkshire Terrier

Parents

Children

Photos

Bitcoin dog race podium