Audrey Andromeda Digital Cryptocurrency Dog - Mix of Maltese, Grey Wolf, St. Bernard, Rottweiler, Beagle, Shiba Inu, German Shepard and Poodle

Achievements

Racer
Audrey Andromeda
You can access my database anytime with your WiFi. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.
  • Purity 8%
  • Age 3 months
  • Racing Exp 8
  • Maltese 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time16.22 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGACACCCCCTACCCACCGTATCAGACACCACC
T
G
A
C
A
C
C
C
C
C
T
A
C
C
C
A
C
C
G
T
A
T
C
A
G
A
C
A
C
C
A
C
C
Genes: BHLDLKE7IKK

Composition

Maltese
27%
Grey Wolf
18%
St. Bernard
9%
Rottweiler
9%
Beagle
9%
Shiba Inu
9%
German Shepard
9%
Poodle
9%

Current Energy

Vitality -32 points
Lunar Effect -14 points

Traits Breakdown

Body St. Bernard
Tail Rottweiler
Legs Grey Wolf
Front Legs Beagle
Head Grey Wolf
Ears Maltese
Snout Shiba Inu
Mouth German Shepard
Nose Poodle
Eyes Maltese
Color Maltese