Moochie Marie Cryptocurrency Dog - Mix of Maltese, Corgi, Yorkshire Terrier, Pug, Grey Wolf, Husky, Pitbull terrier and Labrador BK

Achievements

Racer
Moochie Marie
Hey! My name's Moochie Marie! Once you go digital, baby, you never go back. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 8%
  • Age 31 days
  • Racing Exp 1
  • Maltese 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.65 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAACCCACATCCACCACCGCAAGCTTATTAAGC
G
A
A
C
C
C
A
C
A
T
C
C
A
C
C
A
C
C
G
C
A
A
G
C
T
T
A
T
T
A
A
G
C
Genes: 2L4NKK6OFFO

Composition

Maltese
18%
Corgi
18%
Yorkshire Terrier
18%
Pug
9%
Grey Wolf
9%
Husky
9%
Pitbull terrier
9%
Labrador BK
9%

Current Energy

Vitality +4 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail Grey Wolf
Legs Husky
Front Legs Pitbull terrier
Head Maltese
Ears Maltese
Snout Labrador BK
Mouth Corgi
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Corgi

Parents

No Children

Photos