Paddy Piglet Litecoin Game Dog - Mix of Boxer, French Bulldog, Dachshund, St. Bernard, Corgi, Pug, Schnauzer and Rottweiler

Achievements

Racer
Paddy Piglet
Dragging my butt on the carpet feels so good. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! My favorite game is Fetch except I never bring the ball back. If you are looking for companionship without commitment, so am I.
  • Purity 6%
  • Age 12 months
  • Racing Exp 7
  • Boxer 18%
  • 1 races
  • Gen 0
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time16.42 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCGATGAAACGGAGGACGAAGCGAAATACAC
A
A
C
C
G
A
T
G
A
A
A
C
G
G
A
G
G
A
C
G
A
A
G
C
G
A
A
A
T
A
C
A
C
Genes: G9BGAA9O2CH

Composition

Boxer
18%
French Bulldog
18%
Dachshund
18%
St. Bernard
9%
Corgi
9%
Pug
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -10 points

Traits Breakdown

Body Boxer
Tail French Bulldog
Legs St. Bernard
Front Legs Boxer
Head Dachshund
Ears Dachshund
Snout French Bulldog
Mouth Corgi
Nose Pug
Eyes Schnauzer
Color Rottweiler