Paddy Piglet Litecoin Game Dog - Mix of Boxer, French Bulldog, Dachshund, St. Bernard, Corgi, Pug, Schnauzer and Rottweiler

Achievements

Racer
Paddy Piglet
Dragging my butt on the carpet feels so good. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! My favorite game is Fetch except I never bring the ball back. If you are looking for companionship without commitment, so am I.
  • Purity 6%
  • Age 31 days
  • Racing Exp 7
  • Boxer 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time16.42 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCGATGAAACGGAGGACGAAGCGAAATACAC
A
A
C
C
G
A
T
G
A
A
A
C
G
G
A
G
G
A
C
G
A
A
G
C
G
A
A
A
T
A
C
A
C
Genes: G9BGAA9O2CH

Composition

Boxer
18%
French Bulldog
18%
Dachshund
18%
St. Bernard
9%
Corgi
9%
Pug
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality +12 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail French Bulldog
Legs St. Bernard
Front Legs Boxer
Head Dachshund
Ears Dachshund
Snout French Bulldog
Mouth Corgi
Nose Pug
Eyes Schnauzer
Color Rottweiler

Parents

No Children

Photos

cryptocurrency pet racing