Showboat Sheba Crypto Game Dog - Mix of Grey Wolf, Labrador, Dachshund, Pitbull terrier, Beagle, Poodle, Labrador BK and Corgi

Achievements

Racer
Showboat Sheba
Hullo. My name is Showboat Sheba. I live behind a firewall in the Machine. I'm a serial monogamist. I hate it when I am not the center of attention. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I'm not that picky. Wanna mate?
  • Purity 11%
  • Age 3 months
  • Racing Exp 8
  • Grey Wolf 36%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time17.23 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCAGGATCCCTACCCGACGCACCCCCCAGC
C
C
C
C
C
A
G
G
A
T
C
C
C
T
A
C
C
C
G
A
C
G
C
A
C
C
C
C
C
C
A
G
C
Genes: L5ANDLI6LLO

Composition

Grey Wolf
36%
Labrador
9%
Dachshund
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Dachshund
Front Legs Pitbull terrier
Head Beagle
Ears Grey Wolf
Snout Poodle
Mouth Labrador BK
Nose Grey Wolf
Eyes Grey Wolf
Color Corgi