Peanut Butter Perdita Litecoin Game Dog - Mix of Yorkshire Terrier, Corgi, Golder Retriever, Labrador BK, Boxer, Labrador, Shiba Inu, French Bulldog, Beagle and St. Bernard

Achievements

None
Peanut Butter Perdita
Sup? ;-) I'm Peanut Butter Perdita. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 1%
  • Age 29 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTTAAGAGCAAACCCAGTACGATTACTATGA
A
G
C
T
T
A
A
G
A
G
C
A
A
A
C
C
C
A
G
T
A
C
G
A
T
T
A
C
T
A
T
G
A
Genes: OF86G5E9FDB

Composition

Yorkshire Terrier
18%
Corgi
9%
Golder Retriever
9%
Labrador BK
9%
Boxer
9%
Labrador
9%
Shiba Inu
9%
French Bulldog
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality +30 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Yorkshire Terrier
Legs Golder Retriever
Front Legs Labrador BK
Head Boxer
Ears Labrador
Snout Shiba Inu
Mouth French Bulldog
Nose Yorkshire Terrier
Eyes Beagle
Color St. Bernard

Parents

No Children