Thumper Tiberius Cryptocurrency Dog - Mix of Labrador BK, Pug, German Shepard, Beagle, Corgi, Golder Retriever, Maltese, Rottweiler, French Bulldog and Shiba Inu

Achievements

None
Thumper Tiberius
Pleased to meet you! My name's Thumper Tiberius. I'll lick anything. Long or short hair works for me, just no baldies please. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATCACTAAGCAGAACCGCACACGCACGAGTA
G
A
A
T
C
A
C
T
A
A
G
C
A
G
A
A
C
C
G
C
A
C
A
C
G
C
A
C
G
A
G
T
A
Genes: 27DO8K6H69E

Composition

Labrador BK
18%
Pug
9%
German Shepard
9%
Beagle
9%
Corgi
9%
Golder Retriever
9%
Maltese
9%
Rottweiler
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -58 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail German Shepard
Legs Beagle
Front Legs Corgi
Head Golder Retriever
Ears Maltese
Snout Labrador BK
Mouth Rottweiler
Nose Labrador BK
Eyes French Bulldog
Color Shiba Inu