Chantilly Cleo Litecoin Dog - Mix of Corgi, Rottweiler, Schnauzer, Grey Wolf, German Shepard, Maltese, Husky, Dachshund and Poodle

Achievements

None
Chantilly Cleo
Hello there, my name is Chantilly Cleo. Currently, I live on the information superhighway. I don't like going to the groomer. Leave my beautiful fur alone! I love waking up early then indulging in long afternoon naps. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCATAAGCCCCTCAACCACACACGGAGACCAC
A
G
C
A
T
A
A
G
C
C
C
C
T
C
A
A
C
C
A
C
A
C
A
C
G
G
A
G
A
C
C
A
C
Genes: OCOL7K4HAIH

Composition

Corgi
18%
Rottweiler
18%
Schnauzer
9%
Grey Wolf
9%
German Shepard
9%
Maltese
9%
Husky
9%
Dachshund
9%
Poodle
9%

Current Energy

Vitality +40 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Schnauzer
Legs Corgi
Front Legs Grey Wolf
Head German Shepard
Ears Maltese
Snout Husky
Mouth Rottweiler
Nose Dachshund
Eyes Poodle
Color Rottweiler

Parents

No Children