Chantilly Cleo Litecoin Dog - Mix of Corgi, Rottweiler, Schnauzer, Grey Wolf, German Shepard, Maltese, Husky, Dachshund and Poodle

Achievements

None
Chantilly Cleo
Hello there, my name is Chantilly Cleo. Currently, I live on the information superhighway. I don't like going to the groomer. Leave my beautiful fur alone! I love waking up early then indulging in long afternoon naps. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCATAAGCCCCTCAACCACACACGGAGACCAC
A
G
C
A
T
A
A
G
C
C
C
C
T
C
A
A
C
C
A
C
A
C
A
C
G
G
A
G
A
C
C
A
C
Genes: OCOL7K4HAIH

Composition

Corgi
18%
Rottweiler
18%
Schnauzer
9%
Grey Wolf
9%
German Shepard
9%
Maltese
9%
Husky
9%
Dachshund
9%
Poodle
9%

Current Energy

Vitality -20 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Schnauzer
Legs Corgi
Front Legs Grey Wolf
Head German Shepard
Ears Maltese
Snout Husky
Mouth Rottweiler
Nose Dachshund
Eyes Poodle
Color Rottweiler