Bruno Butterball Litecoin Game Dog - Mix of Corgi, Beagle, Rottweiler, Yorkshire Terrier, St. Bernard, Labrador BK, Maltese, Labrador and Pug

Achievements

None
Bruno Butterball
Ima cyber dog. I don't like going to the groomer. Leave my beautiful fur alone! I'd like to leave my paw prints in the sand next to yours on a moonlit beach. Sometimes I just have to roll in something dead. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACAGCCTATTAAGCTGAGCACTAACCCCAGAA
C
A
C
A
G
C
C
T
A
T
T
A
A
G
C
T
G
A
G
C
A
C
T
A
A
C
C
C
C
A
G
A
A
Genes: HODFOB6DK52

Composition

Corgi
18%
Beagle
18%
Rottweiler
9%
Yorkshire Terrier
9%
St. Bernard
9%
Labrador BK
9%
Maltese
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Corgi
Legs Beagle
Front Legs Yorkshire Terrier
Head Corgi
Ears St. Bernard
Snout Labrador BK
Mouth Beagle
Nose Maltese
Eyes Labrador
Color Pug