Bruno Butterball Litecoin Game Dog - Mix of Corgi, Beagle, Rottweiler, Yorkshire Terrier, St. Bernard, Labrador BK, Maltese, Labrador and Pug

Achievements

None
Bruno Butterball
Ima cyber dog. I don't like going to the groomer. Leave my beautiful fur alone! I'd like to leave my paw prints in the sand next to yours on a moonlit beach. Sometimes I just have to roll in something dead. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACAGCCTATTAAGCTGAGCACTAACCCCAGAA
C
A
C
A
G
C
C
T
A
T
T
A
A
G
C
T
G
A
G
C
A
C
T
A
A
C
C
C
C
A
G
A
A
Genes: HODFOB6DK52

Composition

Corgi
18%
Beagle
18%
Rottweiler
9%
Yorkshire Terrier
9%
St. Bernard
9%
Labrador BK
9%
Maltese
9%
Labrador
9%
Pug
9%

Current Energy

Vitality +15 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Corgi
Legs Beagle
Front Legs Yorkshire Terrier
Head Corgi
Ears St. Bernard
Snout Labrador BK
Mouth Beagle
Nose Maltese
Eyes Labrador
Color Pug

Parents

No Children