Birdo Buddie Litecoin Dog - Mix of Border Collie, Maltese, Labrador BK, Corgi, Dachshund, Schnauzer, Grey Wolf and Shiba Inu

Achievements

None
Birdo Buddie
I'm into leather...if I have the right partner. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 8%
  • Age 31 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGCAAGCGGAACCTACATACCCACCGTATAC
T
A
C
G
C
A
A
G
C
G
G
A
A
C
C
T
A
C
A
T
A
C
C
C
A
C
C
G
T
A
T
A
C
Genes: J6OAKJCLKEJ

Composition

Border Collie
27%
Maltese
18%
Labrador BK
9%
Corgi
9%
Dachshund
9%
Schnauzer
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality +15 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Corgi
Front Legs Dachshund
Head Maltese
Ears Border Collie
Snout Schnauzer
Mouth Grey Wolf
Nose Maltese
Eyes Shiba Inu
Color Border Collie

Parents

No Children