Skyler Smokey Crypto Game Dog - Mix of Husky, Maltese, German Shepard, French Bulldog, Golder Retriever, Pitbull terrier, Dachshund, Beagle and Boxer

Achievements

None
Skyler Smokey
Hola! My name is Skyler Smokey. Watching kids play without me is the worst, no? My 'G' spot is under my chin...scratch me there and I'll growl softly. I like to work out by digging fresh holes in landscaped yards. My favorite place to sleep is under the covers between my humans.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACGAAGATCCACAACCGGACTAACCACAAAC
T
C
A
C
G
A
A
G
A
T
C
C
A
C
A
A
C
C
G
G
A
C
T
A
A
C
C
A
C
A
A
A
C
Genes: 798N4KADK4G

Composition

Husky
18%
Maltese
18%
German Shepard
9%
French Bulldog
9%
Golder Retriever
9%
Pitbull terrier
9%
Dachshund
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail French Bulldog
Legs Golder Retriever
Front Legs Pitbull terrier
Head Husky
Ears Maltese
Snout Dachshund
Mouth Beagle
Nose Maltese
Eyes Husky
Color Boxer