Sweet Tooth Sadie Litecoin Game Dog - Mix of Golder Retriever, Pitbull terrier, Rottweiler, Maltese, Corgi, Dachshund, Schnauzer and Husky

Achievements

None
Sweet Tooth Sadie
I'll lick anything. I like exploring off leash best. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I'd like to leave my paw prints in the sand next to yours on a moonlit beach. If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAACCAGCTCCCACTCCGGACACATAACAAGA
A
G
A
A
C
C
A
G
C
T
C
C
C
A
C
T
C
C
G
G
A
C
A
C
A
T
A
A
C
A
A
G
A
Genes: 8KONHNAHC48

Composition

Golder Retriever
18%
Pitbull terrier
18%
Rottweiler
18%
Maltese
9%
Corgi
9%
Dachshund
9%
Schnauzer
9%
Husky
9%

Current Energy

Vitality -30 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Maltese
Legs Corgi
Front Legs Pitbull terrier
Head Rottweiler
Ears Pitbull terrier
Snout Dachshund
Mouth Rottweiler
Nose Schnauzer
Eyes Husky
Color Golder Retriever