Sweet Tooth Sadie Litecoin Game Dog - Mix of Golder Retriever, Pitbull terrier, Rottweiler, Maltese, Corgi, Dachshund, Schnauzer and Husky

Achievements

None
Sweet Tooth Sadie
I'll lick anything. I like exploring off leash best. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I'd like to leave my paw prints in the sand next to yours on a moonlit beach. If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 6%
  • Age 29 days
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAACCAGCTCCCACTCCGGACACATAACAAGA
A
G
A
A
C
C
A
G
C
T
C
C
C
A
C
T
C
C
G
G
A
C
A
C
A
T
A
A
C
A
A
G
A
Genes: 8KONHNAHC48

Composition

Golder Retriever
18%
Pitbull terrier
18%
Rottweiler
18%
Maltese
9%
Corgi
9%
Dachshund
9%
Schnauzer
9%
Husky
9%

Current Energy

Vitality +30 points
Lunar Effect +8 points

Traits Breakdown

Body Golder Retriever
Tail Maltese
Legs Corgi
Front Legs Pitbull terrier
Head Rottweiler
Ears Pitbull terrier
Snout Dachshund
Mouth Rottweiler
Nose Schnauzer
Eyes Husky
Color Golder Retriever

Parents

No Children