Paris Pac-Man Cryptocurrency Dog - Mix of Grey Wolf, Corgi, Labrador BK, Border Collie, Schnauzer, Pug, Maltese, French Bulldog, Pitbull terrier and Husky

Achievements

None
Paris Pac-Man
I'm Paris Pac-Man. What do they call you? I've been known to run with bad dogs. I am a proud show dog. I like showing off my perfect coat! My favorite way to relax is to be scratched on my belly. I'm looking to share time together and not just to be an accessory.
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCGCATACCCCCCCATAGAAACCCGATCCACA
A
G
C
G
C
A
T
A
C
C
C
C
C
C
C
A
T
A
G
A
A
A
C
C
C
G
A
T
C
C
A
C
A
Genes: O6JLLC2K9N4

Composition

Grey Wolf
18%
Corgi
9%
Labrador BK
9%
Border Collie
9%
Schnauzer
9%
Pug
9%
Maltese
9%
French Bulldog
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +45 points
Lunar Effect +2 points

Traits Breakdown

Body Corgi
Tail Labrador BK
Legs Border Collie
Front Legs Grey Wolf
Head Grey Wolf
Ears Schnauzer
Snout Pug
Mouth Maltese
Nose French Bulldog
Eyes Pitbull terrier
Color Husky