Rex Ruthie Digital Cryptocurrency Game Dog - Mix of Labrador, Schnauzer, Border Collie, Maltese, German Shepard, Yorkshire Terrier, French Bulldog and Grey Wolf

Achievements

None
Rex Ruthie
Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. I'm into recreational spankings and a little 'ruff' play. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Labrador 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCAATATACCCAACCTCATTACCACGACCC
C
C
A
C
C
A
A
T
A
T
A
C
C
C
A
A
C
C
T
C
A
T
T
A
C
C
A
C
G
A
C
C
C
Genes: 55CJ5K7F59L

Composition

Labrador
36%
Schnauzer
9%
Border Collie
9%
Maltese
9%
German Shepard
9%
Yorkshire Terrier
9%
French Bulldog
9%
Grey Wolf
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Schnauzer
Front Legs Border Collie
Head Labrador
Ears Maltese
Snout German Shepard
Mouth Yorkshire Terrier
Nose Labrador
Eyes French Bulldog
Color Grey Wolf