Chun-Li C3Po Crypto Game Dog - Mix of Rottweiler, Labrador, Grey Wolf, Boxer, Labrador BK, Pitbull terrier and Poodle

Achievements

None
Chun-Li C3Po
How YOU doin'? Chun-Li C3Po here. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Let me have a pig's ear and I'm in heaven. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff.
  • Purity 9%
  • Age 32 days
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCCAGCACCACACCACTCCCCCCACCCCGAC
A
A
C
C
C
A
G
C
A
C
C
A
C
A
C
C
A
C
T
C
C
C
C
C
C
A
C
C
C
C
G
A
C
Genes: G565HHNLHLI

Composition

Rottweiler
27%
Labrador
18%
Grey Wolf
18%
Boxer
9%
Labrador BK
9%
Pitbull terrier
9%
Poodle
9%

Current Energy

Vitality +39 points
Lunar Effect -10 points

Traits Breakdown

Body Boxer
Tail Labrador
Legs Labrador BK
Front Legs Labrador
Head Rottweiler
Ears Rottweiler
Snout Pitbull terrier
Mouth Grey Wolf
Nose Rottweiler
Eyes Grey Wolf
Color Poodle

Parents

No Children