Chun-Li C3Po Crypto Game Dog - Mix of Rottweiler, Labrador, Grey Wolf, Boxer, Labrador BK, Pitbull terrier and Poodle

Achievements

None
Chun-Li C3Po
How YOU doin'? Chun-Li C3Po here. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Let me have a pig's ear and I'm in heaven. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff.
  • Purity 9%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCCAGCACCACACCACTCCCCCCACCCCGAC
A
A
C
C
C
A
G
C
A
C
C
A
C
A
C
C
A
C
T
C
C
C
C
C
C
A
C
C
C
C
G
A
C
Genes: G565HHNLHLI

Composition

Rottweiler
27%
Labrador
18%
Grey Wolf
18%
Boxer
9%
Labrador BK
9%
Pitbull terrier
9%
Poodle
9%

Current Energy

Vitality -19 points
Lunar Effect -10 points

Traits Breakdown

Body Boxer
Tail Labrador
Legs Labrador BK
Front Legs Labrador
Head Rottweiler
Ears Rottweiler
Snout Pitbull terrier
Mouth Grey Wolf
Nose Rottweiler
Eyes Grey Wolf
Color Poodle