Persy Puppy Bitcoin Dog - Mix of Pitbull terrier, St. Bernard, Dachshund, Grey Wolf, German Shepard, Poodle and Labrador BK

Achievements

None
Persy Puppy
I love connecting with my friends via pee-mail. What's your favorite bed? Mine is the dirty laundry. I love it when you show a little teeth. Watching kids play without me is the worst, no? I'm looking for someone to make bath time a little more bearable!
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTGATGAGGACCCTCCTCAGACTGAGCATCC
T
C
C
T
G
A
T
G
A
G
G
A
C
C
C
T
C
C
T
C
A
G
A
C
T
G
A
G
C
A
T
C
C
Genes: NBBALN7IB6N

Composition

Pitbull terrier
27%
St. Bernard
27%
Dachshund
9%
Grey Wolf
9%
German Shepard
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail St. Bernard
Legs St. Bernard
Front Legs Dachshund
Head Grey Wolf
Ears Pitbull terrier
Snout German Shepard
Mouth Poodle
Nose St. Bernard
Eyes Labrador BK
Color Pitbull terrier