Thyme Tizzy Crypto Dog - Mix of Border Collie, Boxer, German Shepard, Beagle, Labrador, Husky, Pug, French Bulldog and Labrador BK

Achievements

None
Thyme Tizzy
I answer to 'Thyme Tizzy'. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Creativity is my middle name... I turn everything in to a chew toy. I don't appreciate being around bores who bark too much. I'm just looking for some puppy love.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACTACCAACATACAACGAAAACCGATACGCA
T
C
A
C
T
A
C
C
A
A
C
A
T
A
C
A
A
C
G
A
A
A
A
C
C
G
A
T
A
C
G
C
A
Genes: 7D54JG2G9J6

Composition

Border Collie
18%
Boxer
18%
German Shepard
9%
Beagle
9%
Labrador
9%
Husky
9%
Pug
9%
French Bulldog
9%
Labrador BK
9%

Current Energy

Vitality +65 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Labrador
Front Legs Husky
Head Border Collie
Ears Boxer
Snout Pug
Mouth Boxer
Nose French Bulldog
Eyes Border Collie
Color Labrador BK

Parents

No Children