Booker Bianca Digital Cryptocurrency Game Dog - Mix of Labrador, German Shepard, Golder Retriever, Pug, Dachshund, Corgi and French Bulldog

Achievements

None
Booker Bianca
Ima cyber dog. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Small yappy creatures bug me...they disturb my zen. I've had my nose rubbed in 'it' more than once. I'm looking for some ruff play. Wanna bite me?
  • Purity 9%
  • Age 29 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACCATCAAGATCAGGAAGCGAAGAACGAAGA
C
C
A
C
C
A
T
C
A
A
G
A
T
C
A
G
G
A
A
G
C
G
A
A
G
A
A
C
G
A
A
G
A
Genes: 55787AO2298

Composition

Labrador
18%
German Shepard
18%
Golder Retriever
18%
Pug
18%
Dachshund
9%
Corgi
9%
French Bulldog
9%

Current Energy

Vitality +60 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs German Shepard
Front Legs Golder Retriever
Head German Shepard
Ears Dachshund
Snout Corgi
Mouth Pug
Nose Pug
Eyes French Bulldog
Color Golder Retriever

Parents

No Children