Mega Man Marty Litecoin Dog - Mix of Boxer, Yorkshire Terrier, St. Bernard, Dachshund, Corgi, Pitbull terrier, Labrador BK, Maltese and Poodle

Achievements

None
Mega Man Marty
Hullo. My name is Mega Man Marty. Currently, I live on the information superhighway. I'm into group dog piles, the more the better. I like to work out by digging fresh holes in landscaped yards. My favorite place in the world is the dog park. So many smells!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAGGAAGCTCCGCAAACACCTTAGACTTAAAC
T
G
A
G
G
A
A
G
C
T
C
C
G
C
A
A
A
C
A
C
C
T
T
A
G
A
C
T
T
A
A
A
C
Genes: BAON6GKFIFG

Composition

Boxer
18%
Yorkshire Terrier
18%
St. Bernard
9%
Dachshund
9%
Corgi
9%
Pitbull terrier
9%
Labrador BK
9%
Maltese
9%
Poodle
9%

Current Energy

Vitality -47 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Dachshund
Legs Corgi
Front Legs Pitbull terrier
Head Labrador BK
Ears Boxer
Snout Maltese
Mouth Yorkshire Terrier
Nose Poodle
Eyes Yorkshire Terrier
Color Boxer