Cyrano Clancy Crypto Game Dog - Mix of St. Bernard, Grey Wolf, Beagle, Pitbull terrier, Husky, German Shepard, Shiba Inu, Yorkshire Terrier, French Bulldog, Labrador and Border Collie

Achievements

None
Cyrano Clancy
When I hook up, I stay hooked up for about 20 minutes. Squeaky toys are the best, don't you agree? I hate being left alone all day. I love the smell of freshly cut grass.
  • Purity 0%
  • Age 29 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGACCCCTATCCACATCAGTATTACGACCATAC
T
G
A
C
C
C
C
T
A
T
C
C
A
C
A
T
C
A
G
T
A
T
T
A
C
G
A
C
C
A
T
A
C
Genes: BLDN47EF95J

Composition

St. Bernard
9%
Grey Wolf
9%
Beagle
9%
Pitbull terrier
9%
Husky
9%
German Shepard
9%
Shiba Inu
9%
Yorkshire Terrier
9%
French Bulldog
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality -1 points
Lunar Effect +12 points

Traits Breakdown

Body St. Bernard
Tail Grey Wolf
Legs Beagle
Front Legs Pitbull terrier
Head Husky
Ears German Shepard
Snout Shiba Inu
Mouth Yorkshire Terrier
Nose French Bulldog
Eyes Labrador
Color Border Collie

Parents

No Children