Killer Khloe Digital Cryptocurrency Game Dog - Mix of Yorkshire Terrier, Shiba Inu, French Bulldog, Golder Retriever, Labrador BK, Corgi, Grey Wolf, St. Bernard and German Shepard

Achievements

None
Killer Khloe
Hello, I be Killer Khloe. Long or short hair works for me, just no baldies please. I love fetching anything my human throws! Air Bud is definitely my favorite movie. What a role model! I am not above stealing food off humans' plates. I want a mate that knows how to give a proper belly rub!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACGAAGAGCAAGCGTACCCTGATCATTAGTA
T
T
A
C
G
A
A
G
A
G
C
A
A
G
C
G
T
A
C
C
C
T
G
A
T
C
A
T
T
A
G
T
A
Genes: F986OELB7FE

Composition

Yorkshire Terrier
18%
Shiba Inu
18%
French Bulldog
9%
Golder Retriever
9%
Labrador BK
9%
Corgi
9%
Grey Wolf
9%
St. Bernard
9%
German Shepard
9%

Current Energy

Vitality -22 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail French Bulldog
Legs Golder Retriever
Front Legs Labrador BK
Head Corgi
Ears Shiba Inu
Snout Grey Wolf
Mouth St. Bernard
Nose German Shepard
Eyes Yorkshire Terrier
Color Shiba Inu