Hulk Hitomi Crypto Game Dog - Mix of Grey Wolf, Labrador, Rottweiler, St. Bernard, Pitbull terrier, Maltese, Schnauzer, Golder Retriever and Border Collie

Achievements

None
Hulk Hitomi
I'm Hulk Hitomi. How goes it? I'm not into dog collars, unless you're into S & M. Once I caught a seagull, but it scared me so I let it go. Squeaky toys are the best, don't you agree? I like to work out by digging fresh holes in landscaped yards.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCACACTGATCCACCCCCATAAGATACCCA
C
C
C
C
C
A
C
A
C
T
G
A
T
C
C
A
C
C
C
C
C
A
T
A
A
G
A
T
A
C
C
C
A
Genes: L5HBNKLC8J5

Composition

Grey Wolf
18%
Labrador
18%
Rottweiler
9%
St. Bernard
9%
Pitbull terrier
9%
Maltese
9%
Schnauzer
9%
Golder Retriever
9%
Border Collie
9%

Current Energy

Vitality -23 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Rottweiler
Front Legs St. Bernard
Head Pitbull terrier
Ears Maltese
Snout Grey Wolf
Mouth Schnauzer
Nose Golder Retriever
Eyes Border Collie
Color Labrador