Audi Audrey Litecoin Game Dog - Mix of Beagle, Labrador BK, Dachshund, Border Collie, German Shepard, Labrador and Poodle

Achievements

None
Audi Audrey
Who's a good dog? Hopefully you! Audi Audrey here. I'm all about a hard drive because you can't do anything with a floppy disc. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 11%
  • Age 32 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACTATACGCATCAGCACCACTAGACGGAGGA
C
T
A
C
T
A
T
A
C
G
C
A
T
C
A
G
C
A
C
C
A
C
T
A
G
A
C
G
G
A
G
G
A
Genes: DDJ6765DIAA

Composition

Beagle
27%
Labrador BK
18%
Dachshund
18%
Border Collie
9%
German Shepard
9%
Labrador
9%
Poodle
9%

Current Energy

Vitality +42 points
Lunar Effect -10 points

Traits Breakdown

Body Beagle
Tail Beagle
Legs Border Collie
Front Legs Labrador BK
Head German Shepard
Ears Labrador BK
Snout Labrador
Mouth Beagle
Nose Poodle
Eyes Dachshund
Color Dachshund

Parents

No Children