Audi Audrey Litecoin Game Dog - Mix of Beagle, Labrador BK, Dachshund, Border Collie, German Shepard, Labrador and Poodle

Achievements

None
Audi Audrey
Who's a good dog? Hopefully you! Audi Audrey here. I'm all about a hard drive because you can't do anything with a floppy disc. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTACTATACGCATCAGCACCACTAGACGGAGGA
C
T
A
C
T
A
T
A
C
G
C
A
T
C
A
G
C
A
C
C
A
C
T
A
G
A
C
G
G
A
G
G
A
Genes: DDJ6765DIAA

Composition

Beagle
27%
Labrador BK
18%
Dachshund
18%
Border Collie
9%
German Shepard
9%
Labrador
9%
Poodle
9%

Current Energy

Vitality -16 points
Lunar Effect -10 points

Traits Breakdown

Body Beagle
Tail Beagle
Legs Border Collie
Front Legs Labrador BK
Head German Shepard
Ears Labrador BK
Snout Labrador
Mouth Beagle
Nose Poodle
Eyes Dachshund
Color Dachshund