Midna Motaro Cryptocurrency Dog - Mix of Golder Retriever, Beagle, Labrador BK, Shiba Inu, St. Bernard, Rottweiler, Schnauzer, French Bulldog and Pitbull terrier

Achievements

None
Midna Motaro
How do you do? I'm Midna Motaro. My favorite chews are underwear and rawhide...the rawhide lasts longer. I enjoy mixing it up once in a while by visiting different dog parks. People food disagrees with me. Whew! You can tell. Aggressive dogs that don't let 'me be me' frustrate me.
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGCAAGAGTATGACACCTAATACGACTATCC
A
G
A
G
C
A
A
G
A
G
T
A
T
G
A
C
A
C
C
T
A
A
T
A
C
G
A
C
T
A
T
C
C
Genes: 868EBHDC9DN

Composition

Golder Retriever
18%
Beagle
18%
Labrador BK
9%
Shiba Inu
9%
St. Bernard
9%
Rottweiler
9%
Schnauzer
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality +36 points
Lunar Effect +12 points

Traits Breakdown

Body Golder Retriever
Tail Labrador BK
Legs Golder Retriever
Front Legs Shiba Inu
Head St. Bernard
Ears Rottweiler
Snout Beagle
Mouth Schnauzer
Nose French Bulldog
Eyes Beagle
Color Pitbull terrier

Parents

No Children