Chaucer Cadillac Litecoin Dog - Mix of Pug, Beagle, Shiba Inu, Corgi, Husky, Labrador BK, German Shepard, Border Collie, Schnauzer and Labrador

Achievements

None
Chaucer Cadillac
Hi, Chaucer Cadillac is my name. Once I caught a seagull, but it scared me so I let it go. I love cuddling up, doggy-style after a romantic evening. My favorite song is "Who Let the Dogs Out?" It was me :) I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGAAGTAAGCACAGCATCATACATAGAACCA
C
T
A
G
A
A
G
T
A
A
G
C
A
C
A
G
C
A
T
C
A
T
A
C
A
T
A
G
A
A
C
C
A
Genes: D2EO467JC25

Composition

Pug
18%
Beagle
9%
Shiba Inu
9%
Corgi
9%
Husky
9%
Labrador BK
9%
German Shepard
9%
Border Collie
9%
Schnauzer
9%
Labrador
9%

Current Energy

Vitality +9 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Shiba Inu
Front Legs Corgi
Head Husky
Ears Labrador BK
Snout German Shepard
Mouth Border Collie
Nose Schnauzer
Eyes Pug
Color Labrador