Missy Max Bitcoin Dog - Mix of Pitbull terrier, Poodle, Shiba Inu, Schnauzer, St. Bernard, Beagle, Yorkshire Terrier, Boxer, Grey Wolf and Pug

Achievements

Racer
Missy Max
Barkjour mi amor! I'm Missy Max. I live in cyberspace. I'll eat my vomit and yours too. I'm not into dog collars, unless you're into S & M. I really enjoy heavy petting. My favorite position is doggie style ;)
  • Purity 1%
  • Age 3 months
  • Racing Exp 7
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time16.53 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTAATATGACTATCCTTATCCAACCCCGAA
G
A
C
G
T
A
A
T
A
T
G
A
C
T
A
T
C
C
T
T
A
T
C
C
A
A
C
C
C
C
G
A
A
Genes: IECBDNFNGL2

Composition

Pitbull terrier
18%
Poodle
9%
Shiba Inu
9%
Schnauzer
9%
St. Bernard
9%
Beagle
9%
Yorkshire Terrier
9%
Boxer
9%
Grey Wolf
9%
Pug
9%

Current Energy

Vitality -47 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Schnauzer
Front Legs St. Bernard
Head Beagle
Ears Pitbull terrier
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Boxer
Eyes Grey Wolf
Color Pug