Morty Macho Digital Cryptocurrency Dog - Mix of Beagle, Shiba Inu, Labrador, Maltese, Golder Retriever, Dachshund, St. Bernard, Pug and Labrador BK

Achievements

Racer
Morty Macho
I'm 100% digital, baby. You know the worst? Watching my humans 'get it on' and I have to lick myself. I love fetching anything my human throws! My favorite sport is catching treats my human throws! If you are looking for companionship without commitment, so am I.
  • Purity 3%
  • Age 31 days
  • Racing Exp 7
  • Beagle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time17.20 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACCAACCAGAGGAGTATGACTAGAAGTAGCA
C
T
A
C
C
A
A
C
C
A
G
A
G
G
A
G
T
A
T
G
A
C
T
A
G
A
A
G
T
A
G
C
A
Genes: D5K8AEBD2E6

Composition

Beagle
18%
Shiba Inu
18%
Labrador
9%
Maltese
9%
Golder Retriever
9%
Dachshund
9%
St. Bernard
9%
Pug
9%
Labrador BK
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Maltese
Front Legs Golder Retriever
Head Dachshund
Ears Shiba Inu
Snout St. Bernard
Mouth Beagle
Nose Pug
Eyes Shiba Inu
Color Labrador BK

Parents

No Children

Photos

virtual canine racing