Grizzly Greenie Litecoin Game Dog - Mix of Boxer, Rottweiler, Maltese, Border Collie, French Bulldog, Pitbull terrier, Shiba Inu and Labrador BK

Achievements

Racer
Grizzly Greenie
How YOU doin'? Grizzly Greenie here. I run with a pack in the data warehouse. I don't understand why my human tries to give me tap water. I expect filtered and distilled! You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I never knew my father.
  • Purity 4%
  • Age 3 months
  • Racing Exp 1
  • Boxer 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.32 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCACTACCGAAACACCTCCACCGTACACGCA
A
A
C
C
A
C
T
A
C
C
G
A
A
A
C
A
C
C
T
C
C
A
C
C
G
T
A
C
A
C
G
C
A
Genes: GHJ9GKNKEH6

Composition

Boxer
18%
Rottweiler
18%
Maltese
18%
Border Collie
9%
French Bulldog
9%
Pitbull terrier
9%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality -22 points
Lunar Effect -6 points

Traits Breakdown

Body Boxer
Tail Rottweiler
Legs Border Collie
Front Legs French Bulldog
Head Boxer
Ears Maltese
Snout Pitbull terrier
Mouth Maltese
Nose Shiba Inu
Eyes Rottweiler
Color Labrador BK