Linus Lucas Digital Cryptocurrency Dog - Mix of Grey Wolf, Shiba Inu, French Bulldog, Husky, Golder Retriever, Poodle, Labrador and Labrador BK

Achievements

Racer
Linus Lucas
Size doesn't matter, I like 'em all. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. You know the worst? Watching my humans 'get it on' when I've got no one. My humans say I bark too much, but I have a lot to say!
  • Purity 4%
  • Age 3 months
  • Racing Exp 1
  • Grey Wolf 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time18.07 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCACAGTAAGAGACCGACCACGAGCACCCGTA
C
C
C
A
C
A
G
T
A
A
G
A
G
A
C
C
G
A
C
C
A
C
G
A
G
C
A
C
C
C
G
T
A
Genes: L4E8I9596LE

Composition

Grey Wolf
18%
Shiba Inu
18%
French Bulldog
18%
Husky
9%
Golder Retriever
9%
Poodle
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -25 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Husky
Legs Shiba Inu
Front Legs Golder Retriever
Head Poodle
Ears French Bulldog
Snout Labrador
Mouth French Bulldog
Nose Labrador BK
Eyes Grey Wolf
Color Shiba Inu