Siri Sugar-Baby Crypto Dog - Mix of Grey Wolf, Beagle, Golder Retriever, Dachshund, Poodle, Labrador BK, Shiba Inu, Yorkshire Terrier, Border Collie and Maltese

Achievements

Racer
Siri Sugar-Baby
Siri Sugar-Baby here. Wanna play? I love it when you show a little teeth. I hate it when my human runs out of poop-bags. How embarrassing! I live life by my favorite quote "Every dog has it's day", but every day is my day! I enjoy staying active, and running circles around puppies and young children.
  • Purity 1%
  • Age 31 days
  • Racing Exp 1
  • Grey Wolf 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.55 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAAGAGGAGACGCAGTACCCTTACCCTACACC
C
T
A
A
G
A
G
G
A
G
A
C
G
C
A
G
T
A
C
C
C
T
T
A
C
C
C
T
A
C
A
C
C
Genes: D8AI6ELFLJK

Composition

Grey Wolf
18%
Beagle
9%
Golder Retriever
9%
Dachshund
9%
Poodle
9%
Labrador BK
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +11 points
Lunar Effect -14 points

Traits Breakdown

Body Beagle
Tail Golder Retriever
Legs Dachshund
Front Legs Poodle
Head Labrador BK
Ears Shiba Inu
Snout Grey Wolf
Mouth Yorkshire Terrier
Nose Grey Wolf
Eyes Border Collie
Color Maltese