Prost Punkin Bitcoin Dog - Mix of Labrador, Beagle, St. Bernard, Pitbull terrier, Schnauzer, Dachshund, German Shepard, Corgi and Labrador BK

Achievements

Racer
Prost Punkin
The Ethernet where I live, rocks. Chasing anything that will run is so much fun, I could do that all day. I never met a leg I didn't want to hump. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets.
  • Purity 4%
  • Age 31 days
  • Racing Exp 1
  • Labrador 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.85 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACCATGACCATCCATAGGATCAAGCGCACCA
C
T
A
C
C
A
T
G
A
C
C
A
T
C
C
A
T
A
G
G
A
T
C
A
A
G
C
G
C
A
C
C
A
Genes: D5B5NCA7O65

Composition

Labrador
27%
Beagle
9%
St. Bernard
9%
Pitbull terrier
9%
Schnauzer
9%
Dachshund
9%
German Shepard
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality +11 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs St. Bernard
Front Legs Labrador
Head Pitbull terrier
Ears Schnauzer
Snout Dachshund
Mouth German Shepard
Nose Corgi
Eyes Labrador BK
Color Labrador

Parents

No Children

Photos