Prost Punkin Bitcoin Dog - Mix of Labrador, Beagle, St. Bernard, Pitbull terrier, Schnauzer, Dachshund, German Shepard, Corgi and Labrador BK

Achievements

Racer
Prost Punkin
The Ethernet where I live, rocks. Chasing anything that will run is so much fun, I could do that all day. I never met a leg I didn't want to hump. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets.
  • Purity 4%
  • Age 3 months
  • Racing Exp 1
  • Labrador 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.85 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTACCATGACCATCCATAGGATCAAGCGCACCA
C
T
A
C
C
A
T
G
A
C
C
A
T
C
C
A
T
A
G
G
A
T
C
A
A
G
C
G
C
A
C
C
A
Genes: D5B5NCA7O65

Composition

Labrador
27%
Beagle
9%
St. Bernard
9%
Pitbull terrier
9%
Schnauzer
9%
Dachshund
9%
German Shepard
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality -30 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs St. Bernard
Front Legs Labrador
Head Pitbull terrier
Ears Schnauzer
Snout Dachshund
Mouth German Shepard
Nose Corgi
Eyes Labrador BK
Color Labrador