Relay Relay Crypto Dog - Mix of Yorkshire Terrier, Husky, Labrador, Poodle, Pitbull terrier, Dachshund, Schnauzer and Corgi

Achievements

Racer
Relay Relay
Salutations! My name's Relay Relay. It turns me on when I can show an older dog a new trick. I'm not into dog collars, unless you're into S & M. After introductory sniffing, I like some licking. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 11%
  • Age 3 months
  • Racing Exp 7
  • Yorkshire Terrier 36%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time15.27 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATTAACATTACCAGACTCCGGATTAATAAGC
T
T
A
T
T
A
A
C
A
T
T
A
C
C
A
G
A
C
T
C
C
G
G
A
T
T
A
A
T
A
A
G
C
Genes: FF4F5INAFCO

Composition

Yorkshire Terrier
36%
Husky
9%
Labrador
9%
Poodle
9%
Pitbull terrier
9%
Dachshund
9%
Schnauzer
9%
Corgi
9%

Current Energy

Vitality -27 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Yorkshire Terrier
Legs Husky
Front Legs Yorkshire Terrier
Head Labrador
Ears Poodle
Snout Pitbull terrier
Mouth Dachshund
Nose Yorkshire Terrier
Eyes Schnauzer
Color Corgi

Parents

Children

Photos

virtual dog race photo