Deuce Darwin Digital Cryptocurrency Dog - Mix of Pitbull terrier, Boxer, Schnauzer, Labrador BK, Shiba Inu, Rottweiler, German Shepard, Grey Wolf and French Bulldog

Achievements

Racer
Deuce Darwin
Hey there... I'm Deuce Darwin. My AI may be artificial, but at least I'm intelligent. I believe running along the beach to catch a stick can be nearly orgasmic. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 3%
  • Age 3 months
  • Racing Exp 1
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time15.73 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCATAGCAGTATCCCACAACTCACCCAACCGA
T
C
C
A
T
A
G
C
A
G
T
A
T
C
C
C
A
C
A
A
C
T
C
A
C
C
C
A
A
C
C
G
A
Genes: NC6ENHG7LG9

Composition

Pitbull terrier
18%
Boxer
18%
Schnauzer
9%
Labrador BK
9%
Shiba Inu
9%
Rottweiler
9%
German Shepard
9%
Grey Wolf
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Schnauzer
Legs Labrador BK
Front Legs Shiba Inu
Head Pitbull terrier
Ears Rottweiler
Snout Boxer
Mouth German Shepard
Nose Grey Wolf
Eyes Boxer
Color French Bulldog