Rafa Rex Litecoin Dog - Mix of Grey Wolf, Corgi, Pitbull terrier, St. Bernard, Beagle, Rottweiler, Border Collie, Yorkshire Terrier, Boxer and Dachshund

Achievements

Racer
Rafa Rex
I live in cyberspace where you can turn me on. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm always up for a nice long walk around the neighborhood. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again!
  • Purity 1%
  • Age 31 days
  • Racing Exp 7
  • Grey Wolf 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time15.58 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTCCTGACTACCCCACTACTTACCCAACGGA
A
G
C
T
C
C
T
G
A
C
T
A
C
C
C
C
A
C
T
A
C
T
T
A
C
C
C
A
A
C
G
G
A
Genes: ONBDLHJFLGA

Composition

Grey Wolf
18%
Corgi
9%
Pitbull terrier
9%
St. Bernard
9%
Beagle
9%
Rottweiler
9%
Border Collie
9%
Yorkshire Terrier
9%
Boxer
9%
Dachshund
9%

Current Energy

Vitality +9 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Pitbull terrier
Legs St. Bernard
Front Legs Beagle
Head Grey Wolf
Ears Rottweiler
Snout Border Collie
Mouth Yorkshire Terrier
Nose Grey Wolf
Eyes Boxer
Color Dachshund

Parents

No Children

Photos

virtual pet race