Data Dilbert Litecoin Dog - Mix of Dachshund, Yorkshire Terrier, Corgi, Poodle, Labrador BK, St. Bernard, Pitbull terrier, Rottweiler, Schnauzer, Border Collie and Golder Retriever

Achievements

None
Data Dilbert
Who's a good dog? Hopefully you! Data Dilbert here. The internet's my home. I never knew my father. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I really enjoy heavy petting. I 'm here for something RUFF ;)
  • Purity 0%
  • Age 31 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATTAAGCGACGCATGATCCCACATATACAGA
G
G
A
T
T
A
A
G
C
G
A
C
G
C
A
T
G
A
T
C
C
C
A
C
A
T
A
T
A
C
A
G
A
Genes: AFOI6BNHCJ8

Composition

Dachshund
9%
Yorkshire Terrier
9%
Corgi
9%
Poodle
9%
Labrador BK
9%
St. Bernard
9%
Pitbull terrier
9%
Rottweiler
9%
Schnauzer
9%
Border Collie
9%
Golder Retriever
9%

Current Energy

Vitality +16 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Corgi
Front Legs Poodle
Head Labrador BK
Ears St. Bernard
Snout Pitbull terrier
Mouth Rottweiler
Nose Schnauzer
Eyes Border Collie
Color Golder Retriever

Parents

No Children