Rain Delay Rookie Bitcoin Dog - Mix of French Bulldog, Maltese, Border Collie, Labrador, Corgi, Labrador BK, Grey Wolf and Pitbull terrier

Achievements

None
Rain Delay Rookie
I adore sleeping upside down with my tongue hanging out! My favorite way to spend playtime is a good game of frisbee. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I'm not into dog collars, unless you're into S & M.
  • Purity 6%
  • Age 30 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAGCCGAACCACCGCACCCTACTCCCGATAC
C
C
A
A
G
C
C
G
A
A
C
C
A
C
C
G
C
A
C
C
C
T
A
C
T
C
C
C
G
A
T
A
C
Genes: 5O9KK6LJN9J

Composition

French Bulldog
18%
Maltese
18%
Border Collie
18%
Labrador
9%
Corgi
9%
Labrador BK
9%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality +12 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Corgi
Legs French Bulldog
Front Legs Maltese
Head Maltese
Ears Labrador BK
Snout Grey Wolf
Mouth Border Collie
Nose Pitbull terrier
Eyes French Bulldog
Color Border Collie

Parents

No Children