Buster-Brown Bob Bitcoin Dog - Mix of Grey Wolf, Dachshund, Labrador, Shiba Inu, St. Bernard, Labrador BK, Border Collie, Schnauzer and Maltese

Achievements

None
Buster-Brown Bob
I'm a super-dog in the internet universe. I like to work out by digging fresh holes in landscaped yards. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCCAGTACCCTGAGCATACGGAATAACCGGA
C
C
C
C
C
A
G
T
A
C
C
C
T
G
A
G
C
A
T
A
C
G
G
A
A
T
A
A
C
C
G
G
A
Genes: L5ELB6JACKA

Composition

Grey Wolf
18%
Dachshund
18%
Labrador
9%
Shiba Inu
9%
St. Bernard
9%
Labrador BK
9%
Border Collie
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality +44 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Shiba Inu
Front Legs Grey Wolf
Head St. Bernard
Ears Labrador BK
Snout Border Collie
Mouth Dachshund
Nose Schnauzer
Eyes Maltese
Color Dachshund