Polly Panther Crypto Game Dog - Mix of Dachshund, Poodle, Maltese, Border Collie, Labrador BK, Boxer, Pug and Rottweiler

Achievements

None
Polly Panther
Whatcha know, honey. Polly Panther here. I enjoy destroying a nice fresh pair of slippers. In my humble opinion the best toy is one of my human's stinky, old socks. Sometimes I just have to roll in something dead. My human is my best friend, looking for someone who is okay with that.
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGACGACTACGGAGCAGGAAACGGAGAACAC
A
C
C
G
A
C
G
A
C
T
A
C
G
G
A
G
C
A
G
G
A
A
A
C
G
G
A
G
A
A
C
A
C
Genes: KIIJA6AGA2H

Composition

Dachshund
27%
Poodle
18%
Maltese
9%
Border Collie
9%
Labrador BK
9%
Boxer
9%
Pug
9%
Rottweiler
9%

Current Energy

Vitality -38 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Poodle
Front Legs Border Collie
Head Dachshund
Ears Labrador BK
Snout Dachshund
Mouth Boxer
Nose Dachshund
Eyes Pug
Color Rottweiler