Polly Panther Crypto Game Dog - Mix of Dachshund, Poodle, Maltese, Border Collie, Labrador BK, Boxer, Pug and Rottweiler

Achievements

None
Polly Panther
Whatcha know, honey. Polly Panther here. I enjoy destroying a nice fresh pair of slippers. In my humble opinion the best toy is one of my human's stinky, old socks. Sometimes I just have to roll in something dead. My human is my best friend, looking for someone who is okay with that.
  • Purity 8%
  • Age 32 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCGACGACTACGGAGCAGGAAACGGAGAACAC
A
C
C
G
A
C
G
A
C
T
A
C
G
G
A
G
C
A
G
G
A
A
A
C
G
G
A
G
A
A
C
A
C
Genes: KIIJA6AGA2H

Composition

Dachshund
27%
Poodle
18%
Maltese
9%
Border Collie
9%
Labrador BK
9%
Boxer
9%
Pug
9%
Rottweiler
9%

Current Energy

Vitality +6 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Poodle
Front Legs Border Collie
Head Dachshund
Ears Labrador BK
Snout Dachshund
Mouth Boxer
Nose Dachshund
Eyes Pug
Color Rottweiler

Parents

No Children