Sly Silver Litecoin Game Dog - Mix of Husky, Beagle, Maltese, French Bulldog, Pug and Golder Retriever

Achievements

None
Sly Silver
You can call me Sly Silver, everybody else does. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I enjoy destroying a nice fresh pair of slippers. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 13%
  • Age 30 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACTAACACGAGAAACCACACTAACCAGAACA
A
C
A
C
T
A
A
C
A
C
G
A
G
A
A
A
C
C
A
C
A
C
T
A
A
C
C
A
G
A
A
C
A
Genes: 4D492K4DK84

Composition

Husky
36%
Beagle
18%
Maltese
18%
French Bulldog
9%
Pug
9%
Golder Retriever
9%

Current Energy

Vitality +30 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Beagle
Legs Husky
Front Legs French Bulldog
Head Pug
Ears Maltese
Snout Husky
Mouth Beagle
Nose Maltese
Eyes Golder Retriever
Color Husky

Parents

No Children