Bootie Biggie Litecoin Dog - Mix of Shiba Inu, German Shepard, Maltese, Pug, Boxer, Beagle, Husky, Labrador, Rottweiler and Border Collie

Achievements

None
Bootie Biggie
What's up? I'm Bootie Biggie. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My favorite game is Fetch except I never bring the ball back.
  • Purity 1%
  • Age 30 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAACCGAAGTAAACCTAACACCAGTACACTAC
T
C
A
A
C
C
G
A
A
G
T
A
A
A
C
C
T
A
A
C
A
C
C
A
G
T
A
C
A
C
T
A
C
Genes: 7K2EGD45EHJ

Composition

Shiba Inu
18%
German Shepard
9%
Maltese
9%
Pug
9%
Boxer
9%
Beagle
9%
Husky
9%
Labrador
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality +12 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Pug
Front Legs Shiba Inu
Head Boxer
Ears Beagle
Snout Husky
Mouth Labrador
Nose Shiba Inu
Eyes Rottweiler
Color Border Collie

Parents

No Children