Bootie Biggie Litecoin Dog - Mix of Shiba Inu, German Shepard, Maltese, Pug, Boxer, Beagle, Husky, Labrador, Rottweiler and Border Collie

Achievements

None
Bootie Biggie
What's up? I'm Bootie Biggie. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My favorite game is Fetch except I never bring the ball back.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACCGAAGTAAACCTAACACCAGTACACTAC
T
C
A
A
C
C
G
A
A
G
T
A
A
A
C
C
T
A
A
C
A
C
C
A
G
T
A
C
A
C
T
A
C
Genes: 7K2EGD45EHJ

Composition

Shiba Inu
18%
German Shepard
9%
Maltese
9%
Pug
9%
Boxer
9%
Beagle
9%
Husky
9%
Labrador
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Pug
Front Legs Shiba Inu
Head Boxer
Ears Beagle
Snout Husky
Mouth Labrador
Nose Shiba Inu
Eyes Rottweiler
Color Border Collie