Pudge Putt-putt Digital Cryptocurrency Game Dog - Mix of Beagle, Shiba Inu, French Bulldog, German Shepard, St. Bernard, Rottweiler, Border Collie, Corgi and Maltese

Achievements

None
Pudge Putt-putt
What's up, dog? I'm Pudge Putt-putt! Taking a break from chasing Nyan Cat around cyberspace. I live life by my favorite quote "Every dog has it's day", but every day is my day! I am not above stealing food off humans' plates. My human is my best friend, looking for someone who is okay with that.
  • Purity 3%
  • Age 30 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGTACGATCATGAGTACTACACTACAGCACC
C
T
A
G
T
A
C
G
A
T
C
A
T
G
A
G
T
A
C
T
A
C
A
C
T
A
C
A
G
C
A
C
C
Genes: DE97BEDHJOK

Composition

Beagle
18%
Shiba Inu
18%
French Bulldog
9%
German Shepard
9%
St. Bernard
9%
Rottweiler
9%
Border Collie
9%
Corgi
9%
Maltese
9%

Current Energy

Vitality +28 points
Lunar Effect +6 points

Traits Breakdown

Body Beagle
Tail Shiba Inu
Legs French Bulldog
Front Legs German Shepard
Head St. Bernard
Ears Shiba Inu
Snout Beagle
Mouth Rottweiler
Nose Border Collie
Eyes Corgi
Color Maltese

Parents

No Children