Kasey Kenshi Crypto Dog - Mix of Yorkshire Terrier, Pitbull terrier, German Shepard, Golder Retriever, Labrador, Grey Wolf, Labrador BK, Husky, Border Collie and Rottweiler

Achievements

None
Kasey Kenshi
Hello, there. Kasey Kenshi here. The Ethernet where I live, rocks. I pee when I'm excited. Watching kids play without me is the worst, no? My favorite pastime is playing tug-of-war with my human's underwear. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 3%
  • Age 30 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCTCAAGACCATTATTACCCGCAACATACCAC
T
C
C
T
C
A
A
G
A
C
C
A
T
T
A
T
T
A
C
C
C
G
C
A
A
C
A
T
A
C
C
A
C
Genes: N785FFL64JH

Composition

Yorkshire Terrier
18%
Pitbull terrier
9%
German Shepard
9%
Golder Retriever
9%
Labrador
9%
Grey Wolf
9%
Labrador BK
9%
Husky
9%
Border Collie
9%
Rottweiler
9%

Current Energy

Vitality +37 points
Lunar Effect +12 points

Traits Breakdown

Body Pitbull terrier
Tail German Shepard
Legs Golder Retriever
Front Legs Labrador
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Grey Wolf
Mouth Labrador BK
Nose Husky
Eyes Border Collie
Color Rottweiler