Hansel Hairy Paw-ter Bitcoin Dog - Mix of Maltese, Poodle, Golder Retriever, Dachshund, Rottweiler, Pitbull terrier, Grey Wolf, Border Collie, German Shepard and Schnauzer

Achievements

None
Hansel Hairy Paw-ter
As a digital dog, let me say Bob Dole did not invent the internet. I have a crush on the Grumpy cat. I don't like having to stay off the furniture. I love connecting with my friends via pee-mail. My favorite chews are underwear and rawhide...the rawhide lasts longer.
  • Purity 1%
  • Age 30 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACAGAGGACACTCCACCCCCTACTCAACCATA
G
A
C
A
G
A
G
G
A
C
A
C
T
C
C
A
C
C
C
C
C
T
A
C
T
C
A
A
C
C
A
T
A
Genes: I8AHNKLJ7KC

Composition

Maltese
18%
Poodle
9%
Golder Retriever
9%
Dachshund
9%
Rottweiler
9%
Pitbull terrier
9%
Grey Wolf
9%
Border Collie
9%
German Shepard
9%
Schnauzer
9%

Current Energy

Vitality +15 points
Lunar Effect +8 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Dachshund
Front Legs Rottweiler
Head Pitbull terrier
Ears Maltese
Snout Grey Wolf
Mouth Border Collie
Nose German Shepard
Eyes Maltese
Color Schnauzer

Parents

No Children