Megan Mcgruff Virtual Crypto Dog - Mix of Poodle, Boxer, German Shepard, Maltese, Border Collie, Husky, Rottweiler, Pug and Yorkshire Terrier

Achievements

None
Megan Mcgruff
Suh...you good? Megan Mcgruff here. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! Oh, go ahead. Pet me. I know you want to. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Poodle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGACTCAACCTACACACACGAAGACGACTTA
A
A
C
G
A
C
T
C
A
A
C
C
T
A
C
A
C
A
C
A
C
G
A
A
G
A
C
G
A
C
T
T
A
Genes: GI7KJ4H2IIF

Composition

Poodle
27%
Boxer
9%
German Shepard
9%
Maltese
9%
Border Collie
9%
Husky
9%
Rottweiler
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -32 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail Poodle
Legs German Shepard
Front Legs Maltese
Head Border Collie
Ears Husky
Snout Rottweiler
Mouth Pug
Nose Poodle
Eyes Poodle
Color Yorkshire Terrier