Megan Mcgruff Virtual Crypto Dog - Mix of Poodle, Boxer, German Shepard, Maltese, Border Collie, Husky, Rottweiler, Pug and Yorkshire Terrier

Achievements

None
Megan Mcgruff
Suh...you good? Megan Mcgruff here. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! Oh, go ahead. Pet me. I know you want to. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!
  • Purity 6%
  • Age 31 days
  • Racing Exp 0
  • Poodle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACGACTCAACCTACACACACGAAGACGACTTA
A
A
C
G
A
C
T
C
A
A
C
C
T
A
C
A
C
A
C
A
C
G
A
A
G
A
C
G
A
C
T
T
A
Genes: GI7KJ4H2IIF

Composition

Poodle
27%
Boxer
9%
German Shepard
9%
Maltese
9%
Border Collie
9%
Husky
9%
Rottweiler
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality +27 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Poodle
Legs German Shepard
Front Legs Maltese
Head Border Collie
Ears Husky
Snout Rottweiler
Mouth Pug
Nose Poodle
Eyes Poodle
Color Yorkshire Terrier

Parents

No Children