Xena Xander Litecoin Dog - Mix of French Bulldog, Shiba Inu, Yorkshire Terrier, Husky, Labrador, Beagle, Labrador BK and Rottweiler

Achievements

None
Xena Xander
My favorite treat is to steal the pepperoni off of pizza. I like shaking my fur next to humans right after a good swim! I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 4%
  • Age 3 months
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGAGTATTACCACTACGATTAGTAGCACAC
A
C
A
C
G
A
G
T
A
T
T
A
C
C
A
C
T
A
C
G
A
T
T
A
G
T
A
G
C
A
C
A
C
Genes: 49EF5D9FE6H

Composition

French Bulldog
18%
Shiba Inu
18%
Yorkshire Terrier
18%
Husky
9%
Labrador
9%
Beagle
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Shiba Inu
Front Legs Yorkshire Terrier
Head Labrador
Ears Beagle
Snout French Bulldog
Mouth Yorkshire Terrier
Nose Shiba Inu
Eyes Labrador BK
Color Rottweiler