Balrog Big Guy Crypto Game Dog - Mix of St. Bernard, Labrador, Corgi, Labrador BK, Maltese, Shiba Inu, Husky, Boxer and Border Collie

Achievements

None
Balrog Big Guy
Hey there... I'm Balrog Big Guy. I'd like to take you for a byte to eat in cyberspace. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm sick of having my nails clipped, those are to help me dig! If you are looking for companionship without commitment, keep looking.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGCGCACCAACCGTATGAACAAACCCATAC
T
G
A
A
G
C
G
C
A
C
C
A
A
C
C
G
T
A
T
G
A
A
C
A
A
A
C
C
C
A
T
A
C
Genes: BO65KEB4G5J

Composition

St. Bernard
18%
Labrador
18%
Corgi
9%
Labrador BK
9%
Maltese
9%
Shiba Inu
9%
Husky
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect +6 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs Labrador BK
Front Legs Labrador
Head Maltese
Ears Shiba Inu
Snout St. Bernard
Mouth Husky
Nose Boxer
Eyes Labrador
Color Border Collie