Alma Accord Litecoin Game Dog - Mix of Rottweiler, Golder Retriever, Shiba Inu, Labrador BK, Poodle, St. Bernard, Schnauzer, Boxer, Dachshund and Grey Wolf

Achievements

None
Alma Accord
I am a guard dog for the data warehouse. I don't appreciate being around bores who bark too much. My favorite game is Fetch except I never bring the ball back. I've been known to run with bad dogs. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACAGAGTACACGCAGACTGAATAAACGGACCC
C
A
C
A
G
A
G
T
A
C
A
C
G
C
A
G
A
C
T
G
A
A
T
A
A
A
C
G
G
A
C
C
C
Genes: H8EH6IBCGAL

Composition

Rottweiler
18%
Golder Retriever
9%
Shiba Inu
9%
Labrador BK
9%
Poodle
9%
St. Bernard
9%
Schnauzer
9%
Boxer
9%
Dachshund
9%
Grey Wolf
9%

Current Energy

Vitality +14 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Golder Retriever
Legs Shiba Inu
Front Legs Rottweiler
Head Labrador BK
Ears Poodle
Snout St. Bernard
Mouth Schnauzer
Nose Boxer
Eyes Dachshund
Color Grey Wolf

Parents

No Children