Brian Griffin Biggie Cryptocurrency Dog - Mix of Schnauzer, Yorkshire Terrier, Rottweiler, Dachshund, Maltese, Husky, Boxer, German Shepard, French Bulldog and Shiba Inu

Achievements

None
Brian Griffin Biggie
Let me introduce myself, I'm Brian Griffin Biggie. If you enjoy growling through fences as much as I do, we should get together. I like to respond to sad puppy eyes with sad puppy eyes of my own. It turns me on when I can show an older dog a new trick.
  • Purity 1%
  • Age 30 days
  • Racing Exp 0
  • Schnauzer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTACACGGAACCACAAACATATCACGAATAGTA
T
T
A
C
A
C
G
G
A
A
C
C
A
C
A
A
A
C
A
T
A
T
C
A
C
G
A
A
T
A
G
T
A
Genes: FHAK4GC79CE

Composition

Schnauzer
18%
Yorkshire Terrier
9%
Rottweiler
9%
Dachshund
9%
Maltese
9%
Husky
9%
Boxer
9%
German Shepard
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality +10 points
Lunar Effect +8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Rottweiler
Legs Dachshund
Front Legs Maltese
Head Husky
Ears Boxer
Snout Schnauzer
Mouth German Shepard
Nose French Bulldog
Eyes Schnauzer
Color Shiba Inu

Parents

No Children