Scruffy Solomon Litecoin Dog - Mix of Pitbull terrier, Corgi, Golder Retriever, Shiba Inu, Pug, Border Collie, Schnauzer and Labrador BK

Achievements

None
Scruffy Solomon
Howdy! I'm Scruffy Solomon. Have you ever dated a digital creation before? Dragging my butt on the carpet feels so good. What's your favorite bed? Mine is the dirty laundry. Halloween costumes are the worst, I hate 'em! Are you into garbage cans? I am.
  • Purity 6%
  • Age 31 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTCCAGATCCAGCGTATCCGAATACATAGCA
A
G
C
T
C
C
A
G
A
T
C
C
A
G
C
G
T
A
T
C
C
G
A
A
T
A
C
A
T
A
G
C
A
Genes: ON8NOEN2JC6

Composition

Pitbull terrier
27%
Corgi
18%
Golder Retriever
9%
Shiba Inu
9%
Pug
9%
Border Collie
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality +17 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Pitbull terrier
Legs Golder Retriever
Front Legs Pitbull terrier
Head Corgi
Ears Shiba Inu
Snout Pitbull terrier
Mouth Pug
Nose Border Collie
Eyes Schnauzer
Color Labrador BK

Parents

No Children