Bean Buzzy Crypto Game Dog - Mix of Yorkshire Terrier, German Shepard, Pug, Labrador BK, Boxer, Rottweiler, Schnauzer and Golder Retriever

Achievements

None
Bean Buzzy
I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My humans say I bark too much, but I have a lot to say! I love a good book... I find them quite tasty. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 4%
  • Age 30 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGCATTAAACTCAGAACACATAGAAAGATCA
T
T
A
G
C
A
T
T
A
A
A
C
T
C
A
G
A
A
C
A
C
A
T
A
G
A
A
A
G
A
T
C
A
Genes: F6FG72HC287

Composition

Yorkshire Terrier
18%
German Shepard
18%
Pug
18%
Labrador BK
9%
Boxer
9%
Rottweiler
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality +22 points
Lunar Effect -2 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador BK
Legs Yorkshire Terrier
Front Legs Boxer
Head German Shepard
Ears Pug
Snout Rottweiler
Mouth Schnauzer
Nose Pug
Eyes Golder Retriever
Color German Shepard

Parents

No Children